[ overboard / cytube] [ leftypol / b / hobby / tech / edu / games / anime / music ] [ meta ] [ GET / ref]

/leftypol/ - Leftist Politically Incorrect

"The anons of the past have only shitposted on the Internets about the world, in various ways. The point, however, is to change it."
Name
Email
Subject
Comment
Flag
File
Embed
Password (For file deletion.)

We have an onion | Join Matrix Chat

| Catalog | Home

File: 1623296834251.png (56.94 KB, 722x578, useful_work.png)

 No.309183[Reply]

So, I hear that you guys are into "surplus value extraction".

I have some questions.

(1) Do you have any examples of surplus extraction?


(2) Your EPI graph is stupid see:https: //www.piie.com/blogs/realtime-economic-issues-watch/growing-gap-between-real-wages-and-labor-productivity Do you have any better graphs that don't suffer from the problems listed in the analysis?
15 posts and 1 image reply omitted. Click reply to view.
>>

 No.309370

>>

 No.309421

File: 1623309610036.jpg (56.04 KB, 720x720, 1613901945742.jpg)

>>309370
>there is no economic or material justification for ending the extraction of surplus value from the proletariat by the bourgeoisie
>the only thing that matters is freedum and happy heckin communes
The brilliance of leftcoms is…blinding.
>>

 No.310636

>>309234
>Sure, when I'm with your mom I'm usually going for a second round, filling her up with a surplus of cum.

This transhumanist pretending it still makes cum
>>

 No.310703

>>310636
GDR anon actually appeared in a debate before if I remember. He isn't trans.
>>

 No.310759

>>309183
>(1) Do you have any examples of surplus extraction?
Is Jeff Bezos 100,000,000 more productive than his average worker?


File: 1622979314087.jpeg (151.42 KB, 2048x1151, 3A337534-FD8F-4A3E-8568-7….jpeg)

 No.298913[Reply]

Watching ads for them products to consoom honestly looks like watching the sort of shit a coked up schizophrenic would come up with
Man why do these gay ass jannies force me to use extra characters holy shit, there was literally a shitpost last night with a single word
Okay, something something Derrida, something something QAnon, something something evangelicals
81 posts and 19 image replies omitted. Click reply to view.
>>

 No.310247

>>310220
Whatever ultramodernity places under the dominionof signs postmodernity subverts with virus. As culturemigrates into partial-machines (lacking an autonomousreproductive system) semiotics subsides into virotechnics. Yes No Yes No Yes Yes No longerwhat does it mean? but how does it spread?Having no proper substance, or sense beyond its re rere replication, yes no no usage of virus is ever metaphorical. The word ‘virus’ is more re re virus.Postmodern culture re re chatters-out virus virus virusvirus virus virus virus virus virus virus ‘virus’ (viroductile,virogenic, immunosuppressor and and or, meta-, or orand or hyper-) virus.384Fanged Noumena. hypervirus eats the endof history k-(coding for cyber)positive processes auto-intensify by occurring. A cultural example ishype: products that AT AT trade on what they will be inthe future, vir virtual fashion on off, imminent technicalstandards, self-fulfilling prophecies and and or and artificial destinies. Anticipating a trend end end end ACC ACCaccelerates it (which is in itself a re re recursive trend)Hyping collapses sf into CATA CATA catalytic ticefficiency, re-routing tomorrow through what its prospectCT CT CT makes today.Virohyping sweeps through the advertising industry.Everyone will be doing it.Virus is parasitic tic replicator code: an asignifyingsequence of machinic data ATA ATA flow-break on/off,1/0, yang/yin intrinsically destined for war. In place ofmess message-content virodata is assembled bled fromasignifying materials with CATA catalytic (or positively disproportionate) efficiency: intruder passcode, locationalzip-code, pseudogenomic substitute instructions, mutational junk (complex but latent segments), and garbage(redundant scrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrap).Biovirus TA TA TA targets organisms, hacking andreprogramming ATGACTTATCCACGGTACATTCAGTcellular dna to produce more virus virus virus virus virusvirus virus virus. Its enzymic cut-and-past recombinantwetware-splicing crosses singularity when retroviralreverse-transcriptase clicks in (enabling ontogenetic dnarna circuitry and endocellular computation).ATAGGTCATGAATCTA CCGATTGCAGCTGCTATT CCTCGATGATCGCATG GGCTGTGATGGCATCGT ATCCGATCGATTCGAGCGATTGCAGCTACGCTAT TCCTCCGAGGGATTG CAGCTACGTCGCATC GGGCTCAGATGT AGGTCATGAATCTACCGA TTGCATGACTTATCCACGGTACATT CGACTCEthnovirus targets brains Technovirus targets socioeconomic pro proPost too long. Click here to view the full text.
>>

 No.310259

>>310240
I think its Supposed to be an ad for car insurance
>>

 No.310263

>>310259
The only way I see the consumer side of the insurance deal "making lots of money" is insurance fraud, really fucking weird ad.
>>

 No.310638

Neohypermodernism arrives from the neofuture. Postelligence upgrades wired into neotime hyperexit. 55 magazines a second quantified as 256 kb uploads. 25 timecoins. 25 transactions per second. 25 gendercoin apm. Digital datahype, neoage cyborgtime. Neotime hyperexit. Going outside is highly overrated.

Transgender digital activist with a positive attitude. Sonic Level 2-3 in .56 seconds. Hypertime speedrun. Neodata quantifies itself. Bad times good times. Neobad. Hypergood. Neoterritorial deterritime. Metal Gear Solid stealth exit. Final Fantasy VIIstition. Hyperesxit Neotime. Bladerunner MMORPG dropping beneath 60 fps. Neopaypig hypertime. Neoexit. NeoDoom on the Crysis engine. Hyp-erexistition.

No one in the world gets what they want and that is beautiful. Hypertime phallontropy. 360 Noscope Animal Crossing fellatiotory. Plants without animals. Digital city hyperunderworld. Hyperneo.

You were born at a pretty crappy time in history. And it looks like things are only gonna get worse from here on out. Only capital's neopositive attitude from here on out. Sims I speedrun on expert.

Neoexit Mchypertime. Quantocapitalised beings run Mario 3 in 42.5 seconds. High Score 16,357,983. Quantified Neolimits. Neotime. Hypertime. Fast time. Faster than fast. Speedy time. Hyperspeed neotime hyperexit. Neomarxist vathead cyberfemoid. For a bunch of hairless apes, we've actually managed to invent some pretty incredible things.

Quantomeltdown hyperexit. Chrono Trigger hyperexitstition Survival Mode. No flying cars but endless reposts of hyperexit timeblogs. Leisure Suit Larry: Virgin Hack. I burned through all of my extra lives in a matter of minutes, and my two least-favorite words appeared on the screen: GAME OVER.

Neotime Hyperexit. Hyperexit neotime. Timestition hyperonanism. Dilation exercises in your VR. Time to hyper. Skyrim Altmer Pacifist speedrun. Hypertime Neoexit. Digital citystition. A sort of mid-’80s postapocalyptic cyberpunk girl-next-door look. Repestition.

Rock over China. Rock on NeoCongo. Twitter: The Reposts are Coming Around.
>>

 No.310679

>>298913
Because it is. Right now it's basically the middle ages 2.0 updated with TV, facebook and twitter to distract the cattle and make them think it's some super cool modern era.


File: 1618177453602.jpg (455.81 KB, 2500x1169, 1097071_81_101518_iIi33PKN….jpg)

 No.164245[Reply][Last 50 Posts]

We already had a thread like this before. Some great informative posts were made, but it got lost a while ago. Making a new thread, since this is an important topic.

Informative sources
https://climate.nasa.gov/
https://www.ipcc.ch/
248 posts and 52 image replies omitted. Click reply to view.
>>

 No.304251

File: 1623126262039.jpg (97.34 KB, 992x880, stirner.jpg)

>>304250
>caring about humanity
lol
>>

 No.304254

>>304243
We don't need to reach the 'tipping point' to be completely fucked over
>>

 No.304259

File: 1623126542231-0.jpg (152.25 KB, 715x550, fire_outlook_2_t715.jpg)

File: 1623126542231-1.jpg (157.17 KB, 1000x581, Telegraph-Mescal-Fires-11-….jpg)

File: 1623126542231-2.png (340.41 KB, 1200x630, DM_6_1.png)

Shits on fire, burger bros
>>

 No.310641

File: 1623362661231.jpg (113.55 KB, 1008x756, downloadfile.jpg)

Utah's on fire yo

>The fire in the mountains northwest of Helper in Carbon County has grown to 5,479 acres and is 0% contained, according to Utah Fire Info. The cause of the Bear Fire remains under investigation, but it’s believed to have been sparked by lightning on Tuesday afternoon.


>“Our wildfire season is already in full swing, much, much earlier than normal,” Lt. Gov. Deidre Henderson warned during a news conference Thursday — made worse by the state’s drought conditions. “We’re imploring fellow Utahns to be extra cautious when recreating outdoors, and when towing your vehicles.”

https://www.sltrib.com/news/2021/06/10/bear-fire-shuts-down-us/
>>

 No.310653

>>310641
>>304259
The fire rises?


File: 1623091600564-0.jpeg (10.59 KB, 303x166, download (9).jpeg)

File: 1623091600564-1.jpeg (7.59 KB, 158x167, download (8).jpeg)

File: 1623091600564-2.jpeg (8.7 KB, 300x168, download (7).jpeg)

 No.302697[Reply]

theres nothing there, muslims in general are viewed as pests, there are 0 benefits from engaging in war with africans including active drawbacks being that infrastructure and stable governments completely collapse through jihad, and most of these jihadists rely off people that actually contribute to african societies to find a platform to spread there cancerous ideas otherwise they would quickly starve themselves to death
18 posts and 2 image replies omitted. Click reply to view.
>>

 No.304890

File: 1623164995372.png (482.68 KB, 779x460, map.png)

I think these groups might be more like existing tribes / criminal / smuggling organizations that attach themselves to the jihadi brand as a way of networking with larger transnational organizations. The patterns of trade have probably not changed much in centuries.
>>

 No.304974

File: 1623166505867.png (670.03 KB, 1020x569, reallove.png)

hoard goats for hot sex ofc
>>

 No.305134

>>302870
trаnny
>>

 No.305300

File: 1623176607927.png (597.89 KB, 851x664, nothing personnel comrade.png)

>>302840
"no"
Muslims, Christians, and other religions WILL live together in peace under socialism or they will be cleansed from society.
https://www.youtube.com/watch?v=1MGkkQu4sPY
And yes, the Party will regulate what bullshit the imams, priests, and rabbis are allowed to spew.
>>

 No.310618

>>302697
What do you mean? They are fighting for what they perceive as "freedom", the problem is that they are actually illiterate and bought by foreign secret services pretty much from the very start.


File: 1623329635098.jpg (680.51 KB, 2248x1473, European_Ancestry_in_the_U….jpg)

 No.309644[Reply]

Why is Germany or this region of people so overrepresented in literature, science and engineering? Besides Anglos? What makes these people or this region so special? I've only now noticed how many Germans were part of the European settlers in the US and it's odd to me how omnipresent their influence is, right after Anglos.
22 posts omitted. Click reply to view.
>>

 No.309780

>>309644
it was very common in the 19th century for Europeans to move to America to start over, sometimes for a chance at owning land, sometimes for "religious freedom" aka they were religious schizos and cultists who were getting cracked down by the authorities in their own country. Many were from central europe, esp. after the revolutions of 1848
>>

 No.309796

>>309770
Uh… well im from the poorest part of my extended family, there was a feud for a while. We got forgotten in the process, so my direct relatives are poor while my extended relatives are mostly middle class. On my mothers' side are irish catholics and on my fathers side are protestants, but i'm pretty sure my parents were abandoned or something for being edgy kooks. Also my dad was a result of cheating
>>

 No.310465

File: 1623358348726.png (387.48 KB, 730x960, 1620174427789.png)

>>309644
Teuton occupied government anon.
>>

 No.310484

>>309644
Well Germany was immensely fractured throughout most of its history, with many small states throughout the land being quasi-independent. This lead to every one of those little states creating their own academia, universities, industrial centers, etc. while leading to a lot of redundancy, this allowed a lot more people to shine in literature, science and engineering, but also in political thought, which lead to lots of political instability in the 19th century, which lead to a big exodus to the US.
>>

 No.310612

>>309734
>Those "Germans" in America… Are they actual Germans or just people with a load of different ancestries but that feel most identified with their german part?
I don't know about everywhere but Texas is very German. They even have their own special Texas German dialect. A lot of the towns have German names New Braunsfel, Fredricksburg, etc.

https://www.mysanantonio.com/news/local/texas/article/Texas-towns-cities-and-places-with-German-names-6857559.php


File: 1623307407379.jpg (109.3 KB, 1014x1000, wmlgh1rxh3661.jpg)

 No.309375[Reply]

Eventually oligarchies start buying up smaller firms and consolidating their supply chains kinda like how socialists simply merge all industrial control into the hands of a single political party. I unironically don't see how my life will change under socialism. I would still be living in a pod, owning nothing and working like a bug. I'm starting to see what anprims are saying. Can someone tell me with a straight face what will change for me under socialism?
24 posts and 2 image replies omitted. Click reply to view.
>>

 No.310000

>>309930
Uhm, being in control and securing pour control through the military I guess…
>>

 No.310053

>>309908
Are you retarded? One wants to enslave you and the other wants to give you free shit and less work hours.
>>

 No.310179

>>309375
Communism is the last stage of monke communism.
>>

 No.310590

>>309375
Fascism is the last stage of capitalism and you're living in it. What comes next is as good as anyone's guess.
>>

 No.310603

>>309908
You don't have any rights faggot, and we'll take those too if you do not fall in line. We have no obligation to give you anything other than food, a home, health, and employment. You don't need bureaucratic faggot "rights" to be secured those things. We mean that things such as food, a home, health, employment are political things to be given as a political "right". The only political "right" that is allowed to exist is the right of society as whole bro dispose of the means of production for it's needs. But as regards individuals, no individual "needs" political "rights".


File: 1623357020629.jpg (32.65 KB, 658x466, original-1474875417.1844.jpg)

 No.310386[Reply]

Hey commies, if the soviet union was so good, how come they banned Lithuania from speaking our own native language? How come you banned lithuanian books? There were secret schools hidden from the russian to teach lithuanian kids normally('1000s killed' why you always lying, why you always lyin)
39 posts and 3 image replies omitted. Click reply to view.
>>

 No.310599

File: 1623361803353.gif (1.49 MB, 1200x1173, trotcraft.gif)

>>310594
Enjoy your "revolution"
>>

 No.310614

>>310599
One, I’m not a trot.
Two, you can critique them for failing and understanding what to learn from the future, but a failed revolution is still an attempt for change through revolutionary means.
>>

 No.310765

>>310521
Did we say a million people were killed in the holocaust? We meant 6 million! Our evidence? Oh no they dug the bodies up and burned them to ashes to hide it.
>>

 No.310768

>>310535
hello there rabbi


File: 1623230190026.jpg (108.75 KB, 980x653, 1623174996002.jpg)

 No.307155[Reply][Last 50 Posts]

SO CLOSE YET SO FAR EDITION
Get in here

This thread is for discussion of the 2021 Peruvian Election. Looks like it's keeps beign a close one, and either one could win this. The Peruvian Left has gone far, however, and has united under a pretty based candidate. Let's watch

The results live : https://www.resultadossep.eleccionesgenerales2021.pe/SEP2021/EleccionesPresidenciales/RePres/T

Prev. threads:
>>>/leftypol_archive/14633 #1
>>>/leftypol_archive/15250 #2
>>>/leftypol_archive/15858 #3
>>>/leftypol_archive/16499 #4
>>>/leftypol_archive/17177 #5
>>>/leftypol_archive/17849 #6
>>305248 #7
631 posts and 118 image replies omitted. Click reply to view.
>>

 No.311040

>>308476
Wha? I-I thought we liked Mr Maupin her? D:
>>

 No.311483

>>310586
ok.
Make a better joke
>>

 No.312429

>>311483
Subhuman retard
>>

 No.323874

>>

 No.326592

>>312429
make funny joke


File: 1623304467883.mp4 (2.67 MB, 192x144, poor_turtle_in_iraq_mounta….mp4)

 No.309343[Reply]

In an post-revolotion world, would produciton of unnecessary commodity dissapear?
Eg.Car mods, luxury meat, quality clothing (like silk) entertaintment, hell even boats for personal travel.

What will happen to luxury/unnecessary commodity? Will productive forces keep producing them even if they did, how could we exchange the value for the commodity, I cant understand.
Sorry if my english is bad.
17 posts and 3 image replies omitted. Click reply to view.
>>

 No.310150

>>309844
Bringy looks useful for people who owns a dog?
>>

 No.310159

>>309844
>Glow in the dark dog toy
No thanks, I don't want Terry Davis running over my pet
>>

 No.310170

>>310150
A simple tennis ball works. You don't need such data as dogs are smart enough to know when they have played enough and will let you know when they need to drink or had enough running around.
>>

 No.310180

File: 1623352582220.jpg (137.83 KB, 1552x873, b6dc048d1546c7f09279cfa0db….jpg)

>>310150
You've heard of the smart tennis ball, but have you heard of the smart shoes?
>>

 No.310222

>>309349
>>309343
I think OP is talking about truly useless things like toys and games, which could be sufficed with allowing free acess to the resource market for all in times of surplus so that people can make their own stuff as a hobby
>>309844
>>310180
we might actually go full ted k before the internet of things can be put into productive use


File: 1623352145230.jpeg (9.65 KB, 327x137, 1609586727069.jpeg)

 No.310165[Reply]

muh liberty mkay? but with no individuality and you can't do anything that society doesn't accept, duh. temporary state bro it does not change into a dictatorship bro, i can promise bro.
19 posts and 5 image replies omitted. Click reply to view.
>>

 No.310252

File: 1623354458178.png (14.28 KB, 194x158, The Island.png)

>>310224
Ok, when are you leaving?
>>

 No.310257

File: 1623354533737.jpg (162.26 KB, 1024x768, capitalism1.jpg)

>>310171
>muh stalin
>>

 No.310262

>>310248
>open a green text and reply it with brainlet photo
>le_capitalist_pig_destroyed.mp4
>>

 No.310475

>>310262
>i have no brain and i must seethe
>>

 No.310490

File: 1623358915485.png (237.44 KB, 1904x882, tito.png)



Delete Post [ ]
[ overboard / cytube] [ leftypol / b / hobby / tech / edu / games / anime / music ] [ meta ] [ GET / ref]
[ 1 / 2 / 3 / 4 / 5 / 6 / 7 / 8 / 9 / 10 / 11 / 12 / 13 / 14 / 15 / 16 / 17 / 18 / 19 / 20 / 21 / 22 / 23 / 24 / 25 / 26 / 27 / 28 / 29 / 30 / 31 / 32 / 33 / 34 / 35 / 36 ]
| Catalog | Home